Transcript: Human XM_024448230.1

PREDICTED: Homo sapiens AT-rich interaction domain 5B (ARID5B), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARID5B (84159)
Length:
7431
CDS:
518..3517

Additional Resources:

NCBI RefSeq record:
XM_024448230.1
NBCI Gene record:
ARID5B (84159)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000365578 ATAGAACGAATACCCTATTTA pLKO_005 965 CDS 100% 15.000 21.000 N ARID5B n/a
2 TRCN0000151281 CGATAGAACGAATACCCTATT pLKO.1 963 CDS 100% 10.800 15.120 N ARID5B n/a
3 TRCN0000370859 TGCGATGAGTTTGCGCCAAAT pLKO_005 671 CDS 100% 10.800 15.120 N ARID5B n/a
4 TRCN0000155854 CGAGGAAGAAACGAACGTGAT pLKO.1 460 5UTR 100% 4.050 5.670 N ARID5B n/a
5 TRCN0000151171 GCCGTGCATTTGTATTGAAAT pLKO.1 5439 3UTR 100% 13.200 10.560 N ARID5B n/a
6 TRCN0000152535 GCCGAATAACAACAGAGTCTA pLKO.1 4586 3UTR 100% 4.950 3.960 N ARID5B n/a
7 TRCN0000153991 CATGGCAGATTACATTGCCAA pLKO.1 1804 CDS 100% 0.264 0.211 N ARID5B n/a
8 TRCN0000365579 TACCCTTTAGCTGCTATAAAT pLKO_005 3437 CDS 100% 0.000 0.000 N ARID5B n/a
9 TRCN0000111953 CGTCAGTGGAAACATATTTAT pLKO.1 1064 CDS 100% 15.000 10.500 N Arid5b n/a
10 TRCN0000370799 ATAGAGTTAGAAGTCAGTATT pLKO_005 3590 3UTR 100% 13.200 9.240 N ARID5B n/a
11 TRCN0000151040 GCCTTCAAAGAGAACCATTTA pLKO.1 6806 3UTR 100% 13.200 9.240 N ARID5B n/a
12 TRCN0000231326 GAATGCTGAGCCAACTATAAA pLKO_005 7259 3UTR 100% 15.000 9.000 N LOC100044968 n/a
13 TRCN0000154242 CTACACCTGTAGGAAGTTCAT pLKO.1 3390 CDS 100% 4.950 2.970 N ARID5B n/a
14 TRCN0000155468 GCATCCAGGATAAGCCATCTT pLKO.1 528 CDS 100% 4.950 2.970 N ARID5B n/a
15 TRCN0000153360 GCTGCTATAAATCCTCAAGCT pLKO.1 3446 CDS 100% 2.640 1.584 N ARID5B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448230.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.