Transcript: Human XM_024448411.1

PREDICTED: Homo sapiens folate hydrolase 1 (FOLH1), transcript variant X16, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FOLH1 (2346)
Length:
5515
CDS:
4159..5394

Additional Resources:

NCBI RefSeq record:
XM_024448411.1
NBCI Gene record:
FOLH1 (2346)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000006810 CCCAAATAAGACTCATCCCAA pLKO.1 377 5UTR 100% 2.640 1.584 N FOLH1 n/a
2 TRCN0000006808 CCCAACTACATCTCAATAATT pLKO.1 393 5UTR 100% 15.000 7.500 Y FOLH1 n/a
3 TRCN0000427513 GAGTCATTCCCAGGAATTTAT pLKO_005 5248 CDS 100% 15.000 7.500 Y FOLH1B n/a
4 TRCN0000006809 CCAATGAAGCTACTAACATTA pLKO.1 157 5UTR 100% 13.200 6.600 Y FOLH1 n/a
5 TRCN0000414521 CTTTATGAAAGTTGGACTAAA pLKO_005 4711 CDS 100% 13.200 6.600 Y FOLH1B n/a
6 TRCN0000430965 TTCGAGGAGGGATGGTGTTTG pLKO_005 4970 CDS 100% 10.800 5.400 Y FOLH1B n/a
7 TRCN0000118403 CCTGGCTTTACTGGAAACTTT pLKO.1 4225 CDS 100% 5.625 2.813 Y FOLH1B n/a
8 TRCN0000006807 GCACGAACTGAAGACTTCTTT pLKO.1 558 5UTR 100% 5.625 2.813 Y FOLH1 n/a
9 TRCN0000118406 GTCGAGATTATGCTGTAGTTT pLKO.1 5024 CDS 100% 5.625 2.813 Y FOLH1B n/a
10 TRCN0000006811 CCACTGTATCACAGTGTCTAT pLKO.1 4882 CDS 100% 0.495 0.248 Y FOLH1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448411.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.