Transcript: Human XM_024448431.1

PREDICTED: Homo sapiens ETS homologous factor (EHF), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EHF (26298)
Length:
6383
CDS:
1124..2026

Additional Resources:

NCBI RefSeq record:
XM_024448431.1
NBCI Gene record:
EHF (26298)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000017078 CCGAGCTATGAGATATTACTA pLKO.1 1915 CDS 100% 5.625 7.875 N EHF n/a
2 TRCN0000430033 AGAACTCCTGGACGTAAATAT pLKO_005 2081 3UTR 100% 15.000 12.000 N EHF n/a
3 TRCN0000431268 AGTCCACACACAATGTCATTG pLKO_005 1491 CDS 100% 10.800 7.560 N EHF n/a
4 TRCN0000017082 CATCCTCTTGAACCCAGACAA pLKO.1 1768 CDS 100% 4.950 3.465 N EHF n/a
5 TRCN0000017080 GTAGATTTGTTGGACAGCAAA pLKO.1 1595 CDS 100% 4.950 3.465 N EHF n/a
6 TRCN0000017079 GCCAATTGTATCCCTTTCCAA pLKO.1 1331 CDS 100% 3.000 2.100 N EHF n/a
7 TRCN0000017081 GTGCAATGTTTCCAGTGGGTT pLKO.1 1213 CDS 100% 2.640 1.848 N EHF n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448431.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02956 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02956 pLX_304 0% 100% 100% V5 n/a
Download CSV