Transcript: Human XM_024448520.1

PREDICTED: Homo sapiens Rho GTPase activating protein 1 (ARHGAP1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ARHGAP1 (392)
Length:
3307
CDS:
160..1347

Additional Resources:

NCBI RefSeq record:
XM_024448520.1
NBCI Gene record:
ARHGAP1 (392)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448520.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000047298 CCTCGCCAAGTGCTCAAATAT pLKO.1 646 CDS 100% 15.000 12.000 N ARHGAP1 n/a
2 TRCN0000047301 GTGGATTTCGACCAGTACAAT pLKO.1 934 CDS 100% 5.625 3.938 N ARHGAP1 n/a
3 TRCN0000307776 GTGGATTTCGACCAGTACAAT pLKO_005 934 CDS 100% 5.625 3.938 N ARHGAP1 n/a
4 TRCN0000047302 CTCGGATGAAATGCCTGACTT pLKO.1 261 CDS 100% 4.950 3.465 N ARHGAP1 n/a
5 TRCN0000307773 CTCGGATGAAATGCCTGACTT pLKO_005 261 CDS 100% 4.950 3.465 N ARHGAP1 n/a
6 TRCN0000047300 GCATCCAACCATGTTCATCAA pLKO.1 510 CDS 100% 4.950 3.465 N ARHGAP1 n/a
7 TRCN0000291688 GCATCCAACCATGTTCATCAA pLKO_005 510 CDS 100% 4.950 3.465 N ARHGAP1 n/a
8 TRCN0000047299 CCCAAGTCAGATGACTCCAAA pLKO.1 283 CDS 100% 4.950 2.970 N ARHGAP1 n/a
9 TRCN0000291746 CCCAAGTCAGATGACTCCAAA pLKO_005 283 CDS 100% 4.950 2.970 N ARHGAP1 n/a
10 TRCN0000097238 CAAGATGACCAACACTAACTT pLKO.1 1182 CDS 100% 5.625 3.938 N Arhgap1 n/a
11 TRCN0000324650 CAAGATGACCAACACTAACTT pLKO_005 1182 CDS 100% 5.625 3.938 N Arhgap1 n/a
12 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 2508 3UTR 100% 4.950 2.475 Y C16orf89 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448520.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.