Transcript: Human XM_024448681.1

PREDICTED: Homo sapiens zinc finger and BTB domain containing 16 (ZBTB16), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZBTB16 (7704)
Length:
3274
CDS:
398..1918

Additional Resources:

NCBI RefSeq record:
XM_024448681.1
NBCI Gene record:
ZBTB16 (7704)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448681.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000367856 GTGCTAGGGAGCTACACTATG pLKO_005 1269 CDS 100% 10.800 15.120 N ZBTB16 n/a
2 TRCN0000012938 CCACCGCAATAGTCAACACTA pLKO.1 586 CDS 100% 4.950 6.930 N ZBTB16 n/a
3 TRCN0000012942 GCAATAGTCAACACTATACTT pLKO.1 591 CDS 100% 0.563 0.788 N ZBTB16 n/a
4 TRCN0000367861 CCACAAGGCTGACGCTGTATT pLKO_005 1414 CDS 100% 13.200 9.240 N ZBTB16 n/a
5 TRCN0000367860 AGATCCTCTTCCACCGCAATA pLKO_005 576 CDS 100% 10.800 7.560 N ZBTB16 n/a
6 TRCN0000012939 GAATGCACTTACTGGCTCATT pLKO.1 1740 CDS 100% 4.950 3.465 N ZBTB16 n/a
7 TRCN0000012940 GTGGACAGTTTGATGACCATA pLKO.1 1004 CDS 100% 4.950 3.465 N ZBTB16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448681.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07165 pDONR223 100% 73.9% 71.4% None (many diffs) n/a
2 ccsbBroad304_07165 pLX_304 0% 73.9% 71.4% V5 (many diffs) n/a
Download CSV