Transcript: Human XM_024448937.1

PREDICTED: Homo sapiens F-box and WD repeat domain containing 8 (FBXW8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXW8 (26259)
Length:
6089
CDS:
171..1763

Additional Resources:

NCBI RefSeq record:
XM_024448937.1
NBCI Gene record:
FBXW8 (26259)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024448937.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004323 GTGTGGTCATTGCGGGATATA pLKO.1 628 CDS 100% 13.200 18.480 N FBXW8 n/a
2 TRCN0000416918 TGGCAGATAGCTGCGGAATTT pLKO_005 963 CDS 100% 13.200 18.480 N FBXW8 n/a
3 TRCN0000419042 GCAAGACGTGGAAGGTGATTG pLKO_005 394 CDS 100% 10.800 15.120 N FBXW8 n/a
4 TRCN0000418540 TACGAATTGGCAATCAATATA pLKO_005 327 CDS 100% 15.000 12.000 N FBXW8 n/a
5 TRCN0000427256 TGGTGTCCGTGTGGGATTATC pLKO_005 1453 CDS 100% 13.200 10.560 N FBXW8 n/a
6 TRCN0000435400 GAAGCAAGATCCTGGTGTATA pLKO_005 1198 CDS 100% 13.200 9.240 N FBXW8 n/a
7 TRCN0000421442 GTCTCCTTTGTGAGGATAAAC pLKO_005 750 CDS 100% 13.200 9.240 N FBXW8 n/a
8 TRCN0000423254 TTTGAGCACGATGCAAGAATA pLKO_005 852 CDS 100% 13.200 9.240 N FBXW8 n/a
9 TRCN0000413898 GAGCCAAGGAACACATGTTAC pLKO_005 520 CDS 100% 10.800 7.560 N FBXW8 n/a
10 TRCN0000004324 CCTTTCCCTATAACCATGTTT pLKO.1 1741 CDS 100% 5.625 3.938 N FBXW8 n/a
11 TRCN0000004325 GCCACAAAGAACAGCTCAGAT pLKO.1 2767 3UTR 100% 4.950 3.465 N FBXW8 n/a
12 TRCN0000004322 GCAGCTTATGAGGATGGGTTT pLKO.1 786 CDS 100% 4.050 2.835 N FBXW8 n/a
13 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3459 3UTR 100% 5.625 2.813 Y KLHL30 n/a
14 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3459 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024448937.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.