Transcript: Human XM_024449031.1

PREDICTED: Homo sapiens cancer susceptibility 1 (CASC1), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CASC1 (55259)
Length:
2318
CDS:
222..1982

Additional Resources:

NCBI RefSeq record:
XM_024449031.1
NBCI Gene record:
CASC1 (55259)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005918 CCTCCACTTACAAACTGTATT pLKO.1 2191 3UTR 100% 13.200 18.480 N CASC1 n/a
2 TRCN0000413834 AGGAGGAACAAGGTGATATTG pLKO_005 1054 CDS 100% 13.200 9.240 N CASC1 n/a
3 TRCN0000418962 GAGCAAGTGGAACCTACTATG pLKO_005 1931 CDS 100% 10.800 7.560 N CASC1 n/a
4 TRCN0000005915 GCATGGTGAAAGACAGGTATT pLKO.1 2230 3UTR 100% 10.800 7.560 N CASC1 n/a
5 TRCN0000005917 CCCTGTTTCAACACCATCAAA pLKO.1 893 CDS 100% 5.625 3.938 N CASC1 n/a
6 TRCN0000005916 CCTTGATTCAAGATGCTCATA pLKO.1 1573 CDS 100% 4.950 3.465 N CASC1 n/a
7 TRCN0000010977 GCCCAAGAAATGAACACGTTT pLKO.1 429 CDS 100% 4.950 3.465 N CASC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449031.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12194 pDONR223 100% 86.5% 86.5% None 1756_1757delTGinsGT;1758_1759ins270 n/a
2 ccsbBroad304_12194 pLX_304 0% 86.5% 86.5% V5 1756_1757delTGinsGT;1758_1759ins270 n/a
3 TRCN0000475818 GCTGGTGTATTTCCTAAACTTGTT pLX_317 21.3% 86.5% 86.5% V5 1756_1757delTGinsGT;1758_1759ins270 n/a
4 ccsbBroadEn_03567 pDONR223 100% 81.7% 81.7% None 0_1ins120;1756_1757delTGinsGT;1758_1759ins270 n/a
5 ccsbBroad304_03567 pLX_304 0% 81.7% 81.7% V5 0_1ins120;1756_1757delTGinsGT;1758_1759ins270 n/a
Download CSV