Transcript: Human XM_024449241.1

PREDICTED: Homo sapiens PTPRF interacting protein alpha 2 (PPFIA2), transcript variant X28, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPFIA2 (8499)
Length:
4538
CDS:
146..3808

Additional Resources:

NCBI RefSeq record:
XM_024449241.1
NBCI Gene record:
PPFIA2 (8499)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355830 GTGGAGCAATGACCGAGTTAT pLKO_005 3355 CDS 100% 13.200 18.480 N PPFIA2 n/a
2 TRCN0000355897 ACGACATGAAAGATCACTAAG pLKO_005 583 CDS 100% 10.800 15.120 N PPFIA2 n/a
3 TRCN0000002965 CTAAGAAGACGAGCAGTGAAA pLKO.1 3884 3UTR 100% 4.950 6.930 N PPFIA2 n/a
4 TRCN0000002963 CCTACCACAATGATGCTCGAA pLKO.1 2517 CDS 100% 2.640 3.696 N PPFIA2 n/a
5 TRCN0000355898 AGCAATTGGACTTCGAGAATA pLKO_005 3388 CDS 100% 13.200 9.240 N PPFIA2 n/a
6 TRCN0000355828 CAATCCACTGCATCGCTTAAA pLKO_005 2983 CDS 100% 13.200 9.240 N PPFIA2 n/a
7 TRCN0000002966 CAAGACTATTACTGGAGCATT pLKO.1 546 CDS 100% 4.950 3.465 N PPFIA2 n/a
8 TRCN0000002964 CCTCCATTACTGCCTCTGTTA pLKO.1 2250 CDS 100% 4.950 3.465 N PPFIA2 n/a
9 TRCN0000002962 GCTGAGAAGGATCGAAGACTA pLKO.1 2759 CDS 100% 4.950 3.465 N PPFIA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449241.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.