Transcript: Human XM_024449308.1

PREDICTED: Homo sapiens NEDD4 binding protein 2 like 2 (N4BP2L2), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
N4BP2L2 (10443)
Length:
2532
CDS:
268..2517

Additional Resources:

NCBI RefSeq record:
XM_024449308.1
NBCI Gene record:
N4BP2L2 (10443)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434633 GCGGAAACTTCATGCTTATTT pLKO_005 1162 CDS 100% 15.000 21.000 N N4BP2L2 n/a
2 TRCN0000168395 GTTCCCTTGAGCTACCATTAT pLKO.1 2294 CDS 100% 13.200 18.480 N N4BP2L2 n/a
3 TRCN0000436689 CAGACAAGAGTAGGTAATAAA pLKO_005 2089 CDS 100% 15.000 10.500 N N4BP2L2 n/a
4 TRCN0000167476 GCAGGACCTCATAAGTTTATA pLKO.1 1390 CDS 100% 15.000 10.500 N N4BP2L2 n/a
5 TRCN0000168827 CCTCTCTAAGGAAGGTGATAA pLKO.1 978 CDS 100% 13.200 9.240 N N4BP2L2 n/a
6 TRCN0000428038 GCTTACCTCAACCGGATATAC pLKO_005 1625 CDS 100% 13.200 9.240 N N4BP2L2 n/a
7 TRCN0000415210 GTTTGCCTTTCAATTAGTAAA pLKO_005 2322 CDS 100% 13.200 9.240 N N4BP2L2 n/a
8 TRCN0000143431 GCTCAGATGTTGGATCGTTAT pLKO.1 520 CDS 100% 10.800 7.560 N N4BP2L2 n/a
9 TRCN0000167113 CCAGAAATATTGACAGACAAA pLKO.1 1525 CDS 100% 4.950 3.465 N N4BP2L2 n/a
10 TRCN0000167216 CCATCAACATGGAATCAGAAT pLKO.1 1236 CDS 100% 4.950 3.465 N N4BP2L2 n/a
11 TRCN0000168454 GCCATCAACATGGAATCAGAA pLKO.1 1235 CDS 100% 4.950 3.465 N N4BP2L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449308.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.