Transcript: Human XM_024449318.1

PREDICTED: Homo sapiens sperm acrosome associated 7 (SPACA7), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPACA7 (122258)
Length:
744
CDS:
23..604

Additional Resources:

NCBI RefSeq record:
XM_024449318.1
NBCI Gene record:
SPACA7 (122258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449318.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000137530 CAAATCTCCATGGCGATCCTT pLKO.1 381 CDS 100% 3.000 4.200 N SPACA7 n/a
2 TRCN0000136162 GCGATCCTTCTGAGAATTATC pLKO.1 393 CDS 100% 13.200 10.560 N SPACA7 n/a
3 TRCN0000134384 GAAGAGTGTTTCCAGTAAAGA pLKO.1 442 CDS 100% 5.625 3.938 N SPACA7 n/a
4 TRCN0000137603 CTGGCAGTGAGAAGAGTGTTT pLKO.1 432 CDS 100% 4.950 3.465 N SPACA7 n/a
5 TRCN0000135752 CCAATGATGAAGCCAATGCTA pLKO.1 357 CDS 100% 3.000 2.100 N SPACA7 n/a
6 TRCN0000138325 CAACACCGTTACATGCTGGTA pLKO.1 246 CDS 100% 2.640 1.848 N SPACA7 n/a
7 TRCN0000138743 CTGTTGGCAAGAAACTGAGCT pLKO.1 124 CDS 100% 2.640 1.848 N SPACA7 n/a
8 TRCN0000138105 GCGAAATGCCAAGTACAGCAT pLKO.1 216 CDS 100% 2.640 1.848 N SPACA7 n/a
9 TRCN0000136278 GAGAATTATCAAGCTGGTGGT pLKO.1 272 CDS 100% 2.160 1.512 N SPACA7 n/a
10 TRCN0000135890 GCCAAGTACAGCATCAACATT pLKO.1 223 CDS 100% 5.625 3.375 N SPACA7 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449318.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.