Transcript: Human XM_024449522.1

PREDICTED: Homo sapiens fibronectin leucine rich transmembrane protein 2 (FLRT2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FLRT2 (23768)
Length:
10321
CDS:
3140..5122

Additional Resources:

NCBI RefSeq record:
XM_024449522.1
NBCI Gene record:
FLRT2 (23768)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439520 CACGAGCTTGGAGCGTCTTAT pLKO_005 3748 CDS 100% 13.200 10.560 N FLRT2 n/a
2 TRCN0000062638 CGTCAGGGAATTAAATATGAA pLKO.1 4186 CDS 100% 5.625 4.500 N FLRT2 n/a
3 TRCN0000062640 CCTCCACAACAACCAAATTAA pLKO.1 3346 CDS 100% 15.000 10.500 N FLRT2 n/a
4 TRCN0000427593 CATCTGATCAGGCTCTATTTG pLKO_005 3896 CDS 100% 13.200 9.240 N FLRT2 n/a
5 TRCN0000416819 GCGTTATCAAGGCGGACAATT pLKO_005 5137 3UTR 100% 13.200 9.240 N FLRT2 n/a
6 TRCN0000062639 CGGTAGAAGACACCATTTGTT pLKO.1 4647 CDS 100% 5.625 3.938 N FLRT2 n/a
7 TRCN0000062641 GTCTCCTTAAATAACGATCAA pLKO.1 4967 CDS 100% 4.950 3.465 N FLRT2 n/a
8 TRCN0000062642 CCACATTCCTTTGACAGCCTT pLKO.1 3934 CDS 100% 2.640 1.584 N FLRT2 n/a
9 TRCN0000166364 CACACACACACACACACACAA pLKO.1 9206 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449522.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.