Transcript: Human XM_024449829.1

PREDICTED: Homo sapiens abhydrolase domain containing 2 (ABHD2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABHD2 (11057)
Length:
3980
CDS:
478..1755

Additional Resources:

NCBI RefSeq record:
XM_024449829.1
NBCI Gene record:
ABHD2 (11057)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296559 ACATCTAGTTTCCCTATTAAA pLKO_005 2045 3UTR 100% 15.000 21.000 N ABHD2 n/a
2 TRCN0000377341 TACGTGATCGTCCGGTGTTTG pLKO_005 556 CDS 100% 10.800 15.120 N ABHD2 n/a
3 TRCN0000051535 GAAGCAATACATCCGCACTTT pLKO.1 894 CDS 100% 4.950 6.930 N ABHD2 n/a
4 TRCN0000290380 GAAGCAATACATCCGCACTTT pLKO_005 894 CDS 100% 4.950 6.930 N ABHD2 n/a
5 TRCN0000051533 GCGGTTCTACAACTTCCTCAT pLKO.1 1236 CDS 100% 4.050 5.670 N ABHD2 n/a
6 TRCN0000051534 GCACCGGAAGTTCATCACTAT pLKO.1 765 CDS 100% 4.950 3.960 N ABHD2 n/a
7 TRCN0000051537 CGGTACCTGCACAGGATTTAT pLKO.1 1459 CDS 100% 0.000 0.000 N ABHD2 n/a
8 TRCN0000363700 CGGTACCTGCACAGGATTTAT pLKO_005 1459 CDS 100% 0.000 0.000 N ABHD2 n/a
9 TRCN0000296560 GAGGAAGTTTCACGGCTATAA pLKO_005 1401 CDS 100% 13.200 9.240 N ABHD2 n/a
10 TRCN0000369600 CGATCCGTTGGTGCATGAAAG pLKO_005 1509 CDS 100% 10.800 7.560 N ABHD2 n/a
11 TRCN0000377335 TCAGCCTGGGTGGTAACATTG pLKO_005 1094 CDS 100% 10.800 7.560 N ABHD2 n/a
12 TRCN0000051536 CATTTGCCAATGGGAGCGTAA pLKO.1 1686 CDS 100% 4.050 2.835 N ABHD2 n/a
13 TRCN0000121485 CCTGAAGGAATACTATGAGGA pLKO.1 1425 CDS 100% 2.640 1.848 N Abhd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449829.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07738 pDONR223 100% 99.9% 99.7% None 758G>A n/a
2 ccsbBroad304_07738 pLX_304 0% 99.9% 99.7% V5 758G>A n/a
Download CSV