Transcript: Human XM_024450015.1

PREDICTED: Homo sapiens ryanodine receptor 3 (RYR3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RYR3 (6263)
Length:
15744
CDS:
273..14867

Additional Resources:

NCBI RefSeq record:
XM_024450015.1
NBCI Gene record:
RYR3 (6263)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450015.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419641 CATTCCCGAACGCAGATTAAA pLKO_005 9198 CDS 100% 15.000 21.000 N RYR3 n/a
2 TRCN0000053349 CCGGAACACTACAGCCTTATT pLKO.1 1505 CDS 100% 13.200 18.480 N RYR3 n/a
3 TRCN0000053352 CCGTGGTGGTTTATCTCTATA pLKO.1 14287 CDS 100% 13.200 18.480 N RYR3 n/a
4 TRCN0000053348 CCCACCCTTAATCGCTACAAT pLKO.1 9471 CDS 100% 5.625 7.875 N RYR3 n/a
5 TRCN0000053350 CGGGTCCATGAAAGTGTGAAA pLKO.1 4398 CDS 100% 4.950 3.960 N RYR3 n/a
6 TRCN0000436017 AGTGATTTCTACTGGTATTAT pLKO_005 11598 CDS 100% 15.000 10.500 N RYR3 n/a
7 TRCN0000053351 CCAAGAAGATTGAGCGTGTTT pLKO.1 12367 CDS 100% 4.950 3.465 N RYR3 n/a
8 TRCN0000174141 CCAAGAAGATTGAGCGTGTTT pLKO.1 12367 CDS 100% 4.950 3.465 N RYR3 n/a
9 TRCN0000428013 GGAGTTTGATGGCCTATATAT pLKO_005 13799 CDS 100% 15.000 9.000 N RYR3 n/a
10 TRCN0000163739 GAAGAAGAGGAAGAGGAGGAA pLKO.1 6003 CDS 100% 2.640 1.320 Y CCDC88B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450015.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.