Transcript: Human XM_024450216.1

PREDICTED: Homo sapiens KIAA0556 (KIAA0556), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA0556 (23247)
Length:
6639
CDS:
44..4897

Additional Resources:

NCBI RefSeq record:
XM_024450216.1
NBCI Gene record:
KIAA0556 (23247)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450216.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428328 GACCCTCCCGATATCAATATT pLKO_005 3080 CDS 100% 15.000 21.000 N KIAA0556 n/a
2 TRCN0000425246 ACGTTGCCCTGATCAGAATTT pLKO_005 3246 CDS 100% 13.200 18.480 N KIAA0556 n/a
3 TRCN0000412998 ACTTAGTGTAAATCTACAAAG pLKO_005 601 CDS 100% 10.800 15.120 N KIAA0556 n/a
4 TRCN0000142674 CGAAGAACTCTGTTTCGAGAA pLKO.1 362 CDS 100% 4.050 5.670 N KIAA0556 n/a
5 TRCN0000141917 CTGAAACATTAGCGGATGCAA pLKO.1 2028 CDS 100% 3.000 4.200 N KIAA0556 n/a
6 TRCN0000139735 CGATCTTGACATTGGTGCCAA pLKO.1 1783 CDS 100% 2.640 3.696 N KIAA0556 n/a
7 TRCN0000438555 CCTCGTGGTGCTGGAATTTAA pLKO_005 814 CDS 100% 15.000 10.500 N KIAA0556 n/a
8 TRCN0000432179 ATGTCGGCCTCAACGGAATAG pLKO_005 3009 CDS 100% 10.800 7.560 N KIAA0556 n/a
9 TRCN0000414768 GCCTCGTCAACAGGAACTTAG pLKO_005 1623 CDS 100% 10.800 7.560 N KIAA0556 n/a
10 TRCN0000415209 TGAGGGCAGACGAGATCAAAG pLKO_005 1443 CDS 100% 10.800 7.560 N KIAA0556 n/a
11 TRCN0000121578 CCGGATATTAAAGCATTTGAA pLKO.1 181 CDS 100% 5.625 3.938 N KIAA0556 n/a
12 TRCN0000139068 CCAGCGATGAGTATGACTCTA pLKO.1 639 CDS 100% 4.950 3.465 N KIAA0556 n/a
13 TRCN0000122358 CCTGACTCAGAACAGGACAAT pLKO.1 5209 3UTR 100% 4.950 3.465 N KIAA0556 n/a
14 TRCN0000144998 GAGGCCATATTCTATTCTGAT pLKO.1 3440 CDS 100% 4.950 3.465 N KIAA0556 n/a
15 TRCN0000433415 ATACTACCAGAGTGACAGATG pLKO_005 5057 3UTR 100% 4.050 2.835 N KIAA0556 n/a
16 TRCN0000121933 CAAATCATTACCAACGCGAAA pLKO.1 4796 CDS 100% 4.050 2.835 N KIAA0556 n/a
17 TRCN0000141163 CGGCAAATACTTCATGAGCTT pLKO.1 6161 3UTR 100% 2.640 1.848 N KIAA0556 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450216.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.