Transcript: Human XM_024450498.1

PREDICTED: Homo sapiens SEC14 like lipid binding 5 (SEC14L5), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SEC14L5 (9717)
Length:
6498
CDS:
221..2311

Additional Resources:

NCBI RefSeq record:
XM_024450498.1
NBCI Gene record:
SEC14L5 (9717)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000245690 TCCTCATCGAAGCGCACAATG pLKO_005 498 CDS 100% 10.800 15.120 N SEC14L5 n/a
2 TRCN0000245688 CTTGGGCTTCTTGCATCATTA pLKO_005 5253 3UTR 100% 13.200 9.240 N SEC14L5 n/a
3 TRCN0000245689 TTGAGGTGGTTGAGGACAATT pLKO_005 1434 CDS 100% 13.200 9.240 N SEC14L5 n/a
4 TRCN0000245687 TCACTGGACATTCGGTCTTTC pLKO_005 611 CDS 100% 10.800 7.560 N SEC14L5 n/a
5 TRCN0000245691 TGATTGAGCATTACCTGAATG pLKO_005 705 CDS 100% 10.800 7.560 N SEC14L5 n/a
6 TRCN0000165205 GCCTCAGTTTCCTCATCTGTA pLKO.1 5429 3UTR 100% 4.950 2.475 Y YIF1B n/a
7 TRCN0000160434 CAGTTTCCTCATCTGTAAATA pLKO.1 5433 3UTR 100% 15.000 7.500 Y YIF1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450498.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.