Transcript: Human XM_024450581.1

PREDICTED: Homo sapiens TBC1 domain family member 16 (TBC1D16), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TBC1D16 (125058)
Length:
3191
CDS:
144..2237

Additional Resources:

NCBI RefSeq record:
XM_024450581.1
NBCI Gene record:
TBC1D16 (125058)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450581.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000294216 ACAGAGCGTTCTGGCGTAATG pLKO_005 1573 CDS 100% 10.800 15.120 N TBC1D16 n/a
2 TRCN0000061891 GCGAAAGGAGTACTCTGAGAT pLKO.1 1517 CDS 100% 4.950 6.930 N TBC1D16 n/a
3 TRCN0000286829 GCGAAAGGAGTACTCTGAGAT pLKO_005 1517 CDS 100% 4.950 6.930 N TBC1D16 n/a
4 TRCN0000061892 GATCATCTACTCCAAGAACAA pLKO.1 251 CDS 100% 4.950 3.465 N TBC1D16 n/a
5 TRCN0000061889 CCTGTGCTTGTACATGGAGAA pLKO.1 329 CDS 100% 4.050 2.835 N TBC1D16 n/a
6 TRCN0000061890 GTGGAAATACTGCACCGAGAT pLKO.1 1196 CDS 100% 4.050 2.835 N TBC1D16 n/a
7 TRCN0000286830 GTGGAAATACTGCACCGAGAT pLKO_005 1196 CDS 100% 4.050 2.835 N TBC1D16 n/a
8 TRCN0000294217 ACAAGCTGCGGAAGGCCATTT pLKO_005 1387 CDS 100% 10.800 6.480 N TBC1D16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450581.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.