Transcript: Human XM_024450743.1

PREDICTED: Homo sapiens EF-hand calcium binding domain 5 (EFCAB5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EFCAB5 (374786)
Length:
4964
CDS:
193..4536

Additional Resources:

NCBI RefSeq record:
XM_024450743.1
NBCI Gene record:
EFCAB5 (374786)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000147362 GTCCAGATCAACCTAAACTTA pLKO.1 1484 CDS 100% 5.625 7.875 N EFCAB5 n/a
2 TRCN0000147865 GTGGAACTGTTATGGTTGATT pLKO.1 4810 3UTR 100% 5.625 7.875 N EFCAB5 n/a
3 TRCN0000148044 GCCATAGCCAAGTGTATTTAA pLKO.1 4734 3UTR 100% 15.000 12.000 N EFCAB5 n/a
4 TRCN0000427736 AGCAAGTTTGACCCAATTAAT pLKO_005 640 CDS 100% 15.000 10.500 N EFCAB5 n/a
5 TRCN0000150173 CCTCCAAGACTGACAATTATA pLKO.1 4475 CDS 100% 15.000 10.500 N EFCAB5 n/a
6 TRCN0000426844 ACCTTAGATGATGCTCAATTT pLKO_005 3160 CDS 100% 13.200 9.240 N EFCAB5 n/a
7 TRCN0000146577 CCTAAGTCAGTGATTCAGAAT pLKO.1 937 CDS 100% 4.950 3.465 N EFCAB5 n/a
8 TRCN0000146723 CCTTTCAGTTTGAGCTTTGTA pLKO.1 4783 3UTR 100% 5.625 3.375 N EFCAB5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450743.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.