Transcript: Human XM_024450798.1

PREDICTED: Homo sapiens LUC7 like 3 pre-mRNA splicing factor (LUC7L3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LUC7L3 (51747)
Length:
3586
CDS:
571..1812

Additional Resources:

NCBI RefSeq record:
XM_024450798.1
NBCI Gene record:
LUC7L3 (51747)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000075115 CCGGGATCGAAAGTCATATAA pLKO.1 1407 CDS 100% 15.000 21.000 N LUC7L3 n/a
2 TRCN0000286282 CCGGGATCGAAAGTCATATAA pLKO_005 1407 CDS 100% 15.000 21.000 N LUC7L3 n/a
3 TRCN0000305510 GTGTAGGGTTTATGAATTATT pLKO_005 2125 3UTR 100% 15.000 21.000 N Luc7l3 n/a
4 TRCN0000293729 AGGTCCACAACGTCGACAATT pLKO_005 859 CDS 100% 13.200 18.480 N LUC7L3 n/a
5 TRCN0000293728 TGATCGTGATGAGCGTCTAAA pLKO_005 1065 CDS 100% 13.200 18.480 N LUC7L3 n/a
6 TRCN0000075117 CCGGGTAGATGACCATTTGAT pLKO.1 960 CDS 100% 5.625 7.875 N LUC7L3 n/a
7 TRCN0000123510 GCCGAGTAAGAAGACATACAA pLKO.1 1658 CDS 100% 5.625 7.875 N Luc7l3 n/a
8 TRCN0000075116 GCCGAACATCAGACAGAAGAT pLKO.1 1244 CDS 100% 4.950 3.960 N LUC7L3 n/a
9 TRCN0000286216 GCCGAACATCAGACAGAAGAT pLKO_005 1244 CDS 100% 4.950 3.960 N LUC7L3 n/a
10 TRCN0000305454 GGGACCAGTGAAGACATTAAA pLKO_005 1594 CDS 100% 15.000 10.500 N Luc7l3 n/a
11 TRCN0000075114 CCTGCGGAATTGTTCACAAAT pLKO.1 279 5UTR 100% 13.200 9.240 N LUC7L3 n/a
12 TRCN0000375023 CCTGCGGAATTGTTCACAAAT pLKO_005 279 5UTR 100% 13.200 9.240 N Luc7l3 n/a
13 TRCN0000075113 GCATAAAGTGAAGATCGACAT pLKO.1 3114 3UTR 100% 4.050 2.835 N LUC7L3 n/a
14 TRCN0000286218 GCATAAAGTGAAGATCGACAT pLKO_005 3114 3UTR 100% 4.050 2.835 N LUC7L3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450798.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.