Transcript: Human XM_024450893.1

PREDICTED: Homo sapiens sterol regulatory element binding transcription factor 1 (SREBF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SREBF1 (6720)
Length:
4281
CDS:
201..3731

Additional Resources:

NCBI RefSeq record:
XM_024450893.1
NBCI Gene record:
SREBF1 (6720)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024450893.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430514 AGTGTAGGTCAGCGTGCTTAG pLKO_005 4155 3UTR 100% 6.000 8.400 N SREBF1 n/a
2 TRCN0000220196 GCTGAATAAATCTGCTGTCTT pLKO.1 1268 CDS 100% 4.950 6.930 N SREBF1 n/a
3 TRCN0000434619 TATTCCGGGAACATCTCTTAG pLKO_005 2611 CDS 100% 10.800 8.640 N SREBF1 n/a
4 TRCN0000421299 GTGACTTCCCTGGCCTATTTG pLKO_005 322 CDS 100% 13.200 9.240 N SREBF1 n/a
5 TRCN0000422088 TGAGGCTCCTGTGCTACTTTG pLKO_005 4186 3UTR 100% 10.800 7.560 N SREBF1 n/a
6 TRCN0000414192 AGACATGCTTCAGCTTATCAA pLKO_005 290 CDS 100% 5.625 3.938 N SREBF1 n/a
7 TRCN0000220197 CCAGAAACTCAAGCAGGAGAA pLKO.1 1331 CDS 100% 4.050 2.835 N SREBF1 n/a
8 TRCN0000220195 GCCATCGACTACATTCGCTTT pLKO.1 1296 CDS 100% 4.050 2.835 N SREBF1 n/a
9 TRCN0000220198 CTTCTCCATCAGTTCCAGCAT pLKO.1 2768 CDS 100% 2.640 1.848 N SREBF1 n/a
10 TRCN0000220194 CCCTGTGCTGACGGAAGCCAA pLKO.1 4058 3UTR 100% 0.000 0.000 N SREBF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024450893.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06995 pDONR223 100% 97.5% 97.5% None 1896C>T;2602_2688del n/a
2 ccsbBroad304_06995 pLX_304 8.6% 92% 88.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV