Transcript: Human XM_024451084.1

PREDICTED: Homo sapiens lipoxygenase homology domains 1 (LOXHD1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
LOXHD1 (125336)
Length:
5681
CDS:
136..5439

Additional Resources:

NCBI RefSeq record:
XM_024451084.1
NBCI Gene record:
LOXHD1 (125336)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451084.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422008 ACGAGATCACGTACTACTTTC pLKO_005 1958 CDS 100% 10.800 15.120 N LOXHD1 n/a
2 TRCN0000078137 CCTGAACATTGGAAATATCAA pLKO.1 846 CDS 100% 5.625 3.938 N LOXHD1 n/a
3 TRCN0000078134 CCATAATAACACGGGCATGAA pLKO.1 2754 CDS 100% 4.950 3.465 N LOXHD1 n/a
4 TRCN0000078135 CCAACGTCTATCTCTGCCTTT pLKO.1 329 CDS 100% 4.050 2.430 N LOXHD1 n/a
5 TRCN0000078136 CCTCCAAGACAAACAGCGATA pLKO.1 2255 CDS 100% 4.050 2.430 N LOXHD1 n/a
6 TRCN0000121617 GAAGAAGAAGAAGAGGAAGAA pLKO.1 1431 CDS 100% 4.950 2.475 Y ARL6IP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451084.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09491 pDONR223 100% 28.9% 28.9% None 1_3765del;4775C>T n/a
2 ccsbBroad304_09491 pLX_304 0% 28.9% 28.9% V5 1_3765del;4775C>T n/a
Download CSV