Transcript: Human XM_024451242.1

PREDICTED: Homo sapiens thymidylate synthetase (TYMS), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TYMS (7298)
Length:
1176
CDS:
114..674

Additional Resources:

NCBI RefSeq record:
XM_024451242.1
NBCI Gene record:
TYMS (7298)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451242.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045667 CTTTGGGAGATGCACATATTT pLKO.1 484 CDS 100% 15.000 10.500 N TYMS n/a
2 TRCN0000045664 CAGGTGACTTTATACACACTT pLKO.1 466 CDS 100% 4.950 3.465 N TYMS n/a
3 TRCN0000307761 CAGGTGACTTTATACACACTT pLKO_005 466 CDS 100% 4.950 3.465 N TYMS n/a
4 TRCN0000045666 GCAAAGAGTGATTGACACCAT pLKO.1 215 CDS 100% 2.640 1.848 N TYMS n/a
5 TRCN0000291655 GCAAAGAGTGATTGACACCAT pLKO_005 215 CDS 100% 2.640 1.848 N TYMS n/a
6 TRCN0000045663 CCCTGACGACAGAAGAATCAT pLKO.1 245 CDS 100% 5.625 3.375 N TYMS n/a
7 TRCN0000291719 CCCTGACGACAGAAGAATCAT pLKO_005 245 CDS 100% 5.625 3.375 N TYMS n/a
8 TRCN0000075941 GCACATATTTACCTGAATCAT pLKO.1 495 CDS 100% 5.625 3.938 N Tyms n/a
9 TRCN0000349520 GCACATATTTACCTGAATCAT pLKO_005 495 CDS 100% 5.625 3.938 N Tyms n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451242.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.