Transcript: Human XM_024451457.1

PREDICTED: Homo sapiens zinc finger protein 780A (ZNF780A), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF780A (284323)
Length:
7701
CDS:
217..2193

Additional Resources:

NCBI RefSeq record:
XM_024451457.1
NBCI Gene record:
ZNF780A (284323)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108053 CTTACCCTGCTTAATCGCCAT pLKO.1 964 CDS 100% 2.160 3.024 N ZNF780A n/a
2 TRCN0000108051 TGCAATACACATAAACCGTAT pLKO.1 742 CDS 100% 4.050 3.240 N ZNF780A n/a
3 TRCN0000429154 TTCGACTTCACATACAATTTA pLKO_005 872 CDS 100% 15.000 10.500 N ZNF780A n/a
4 TRCN0000420140 TTGCCAACTTATTGAACATTC pLKO_005 1638 CDS 100% 10.800 7.560 N ZNF780A n/a
5 TRCN0000108050 CGGTATCCAGATTTGGAGTTA pLKO.1 490 CDS 100% 4.950 2.970 N ZNF780A n/a
6 TRCN0000108052 GCCTTGTTCAACATCAGAGTA pLKO.1 1727 CDS 100% 4.950 2.970 N ZNF780A n/a
7 TRCN0000108054 CCAATGAGAAACCCTTTGTAT pLKO.1 1166 CDS 100% 5.625 2.813 Y ZNF780A n/a
8 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 763 CDS 100% 4.050 2.025 Y ZNF700 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451457.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.