Transcript: Human XM_024451504.1

PREDICTED: Homo sapiens zinc finger family member 788, pseudogene (ZNF788P), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF788P (388507)
Length:
2582
CDS:
457..1185

Additional Resources:

NCBI RefSeq record:
XM_024451504.1
NBCI Gene record:
ZNF788P (388507)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108004 CACACCTACGAACACATGAAA pLKO.1 2469 3UTR 100% 5.625 3.938 N ZNF788P n/a
2 TRCN0000108003 CTGGTTTCTATCATAGACATA pLKO.1 1296 3UTR 100% 4.950 3.465 N ZNF788P n/a
3 TRCN0000108002 GCCTTCGAATACATGGACTAA pLKO.1 2556 3UTR 100% 4.950 3.465 N ZNF788P n/a
4 TRCN0000108001 GCCTTCAGGTACATGAAGTAA pLKO.1 1722 3UTR 100% 0.563 0.394 N ZNF788P n/a
5 TRCN0000147970 GAATGTAAGGAATGTGGGAAA pLKO.1 1766 3UTR 100% 4.050 2.025 Y ZNF700 n/a
6 TRCN0000243782 TGGAGAGAAACCCTATGAATA pLKO_005 2416 3UTR 100% 13.200 6.600 Y Zfp977 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451504.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.