Transcript: Human XM_024451519.1

PREDICTED: Homo sapiens mitogen-activated protein kinase kinase kinase 10 (MAP3K10), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAP3K10 (4294)
Length:
2999
CDS:
854..2716

Additional Resources:

NCBI RefSeq record:
XM_024451519.1
NBCI Gene record:
MAP3K10 (4294)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000001988 ATGAACTACCTACACAATGAT pLKO.1 619 5UTR 100% 5.625 7.875 N MAP3K10 n/a
2 TRCN0000197237 GCCAGATTTCGGTAGCATCTT pLKO.1 892 CDS 100% 4.950 6.930 N MAP3K10 n/a
3 TRCN0000010674 GCAGGATGTTCACTCTATTTA pLKO.1 2810 3UTR 100% 15.000 10.500 N MAP3K10 n/a
4 TRCN0000231513 GCAGGATGTTCACTCTATTTA pLKO_005 2810 3UTR 100% 15.000 10.500 N MAP3K10 n/a
5 TRCN0000231681 GCATGAACTACCTACACAATG pLKO_005 617 5UTR 100% 10.800 7.560 N MAP3K10 n/a
6 TRCN0000231512 GCCCTCTGGCTTTGAGCATAA pLKO_005 1279 CDS 100% 10.800 7.560 N MAP3K10 n/a
7 TRCN0000381458 GGCCTCTCCAACTCTGGATAA pLKO_005 1312 CDS 100% 10.800 7.560 N MAP3K10 n/a
8 TRCN0000231511 TGGAGATTCAGCACATGTTTG pLKO_005 996 CDS 100% 10.800 7.560 N MAP3K10 n/a
9 TRCN0000001991 GAAGACTGGAAGCTGGAGATT pLKO.1 983 CDS 100% 4.950 3.465 N MAP3K10 n/a
10 TRCN0000001989 GAAGCAAACAGTGGTCATCAA pLKO.1 1596 CDS 100% 4.950 3.465 N MAP3K10 n/a
11 TRCN0000379945 TGCAGCTAGAGGAGATCATCG pLKO_005 293 5UTR 100% 4.050 2.835 N MAP3K10 n/a
12 TRCN0000001990 CCTCAAGTCCATCAACATCCT pLKO.1 666 5UTR 100% 2.640 1.848 N MAP3K10 n/a
13 TRCN0000199108 CCCACACCTCTGCCTAGTGAT pLKO.1 501 5UTR 100% 1.650 0.990 N MAP3K10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451519.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.