Transcript: Human XM_024451808.1

PREDICTED: Homo sapiens transcription factor like 5 (TCFL5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TCFL5 (10732)
Length:
2456
CDS:
88..1683

Additional Resources:

NCBI RefSeq record:
XM_024451808.1
NBCI Gene record:
TCFL5 (10732)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000014609 GCAATTTACATACCCACTGTT pLKO.1 846 CDS 100% 4.950 6.930 N TCFL5 n/a
2 TRCN0000085072 GTTTGGATTAAAGTGGGAGAA pLKO.1 1063 CDS 100% 4.050 3.240 N Tcfl5 n/a
3 TRCN0000422885 CCTGAGCAAGTTTGGATTAAA pLKO_005 1054 CDS 100% 15.000 10.500 N TCFL5 n/a
4 TRCN0000415285 AGACATGGAGATTCTCTTAAA pLKO_005 1444 CDS 100% 13.200 9.240 N TCFL5 n/a
5 TRCN0000435190 CGACATCCATCTGAACTAATG pLKO_005 751 CDS 100% 10.800 7.560 N TCFL5 n/a
6 TRCN0000014610 CCGCATTTGCTGTGATGAGTT pLKO.1 1335 CDS 100% 4.950 3.465 N TCFL5 n/a
7 TRCN0000014612 GAATCCACTAAACAGACGTTA pLKO.1 1012 CDS 100% 4.950 3.465 N TCFL5 n/a
8 TRCN0000014611 GCTATGCAAACAAGCACTGAA pLKO.1 1089 CDS 100% 4.950 3.465 N TCFL5 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 2182 3UTR 100% 4.950 2.475 Y ERAP2 n/a
10 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2183 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451808.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.