Transcript: Human XM_024451885.1

PREDICTED: Homo sapiens EF-hand calcium binding domain 8 (EFCAB8), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
EFCAB8 (388795)
Length:
7192
CDS:
5114..7075

Additional Resources:

NCBI RefSeq record:
XM_024451885.1
NBCI Gene record:
EFCAB8 (388795)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451885.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336666 ACGCCAAAGGCAACGTCATTG pLKO_005 5907 CDS 100% 10.800 15.120 N EFCAB8 n/a
2 TRCN0000336667 GGTTGTCAGTGCTGCGTTTAA pLKO_005 6201 CDS 100% 13.200 10.560 N EFCAB8 n/a
3 TRCN0000336665 CTACTCAATCGGGATCCTAAA pLKO_005 6553 CDS 100% 10.800 7.560 N EFCAB8 n/a
4 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 672 5UTR 100% 13.200 6.600 Y LIAS n/a
5 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 28 5UTR 100% 5.625 2.813 Y KLHL30 n/a
6 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 28 5UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451885.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.