Transcript: Human XM_024451902.1

PREDICTED: Homo sapiens phospholipase C beta 4 (PLCB4), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLCB4 (5332)
Length:
5612
CDS:
229..3813

Additional Resources:

NCBI RefSeq record:
XM_024451902.1
NBCI Gene record:
PLCB4 (5332)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024451902.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007012 CGCTGACATCAGATCACAAAT pLKO.1 3239 CDS 100% 13.200 18.480 N PLCB4 n/a
2 TRCN0000338260 CGCTGACATCAGATCACAAAT pLKO_005 3239 CDS 100% 13.200 18.480 N PLCB4 n/a
3 TRCN0000007011 CGGGAAGTCTTCGGTAGAAAT pLKO.1 1242 CDS 100% 13.200 18.480 N PLCB4 n/a
4 TRCN0000338258 CGGGAAGTCTTCGGTAGAAAT pLKO_005 1242 CDS 100% 13.200 18.480 N PLCB4 n/a
5 TRCN0000007010 GCAGGTTATATCAGGTCAATT pLKO.1 2343 CDS 100% 13.200 9.240 N PLCB4 n/a
6 TRCN0000338259 GCAGGTTATATCAGGTCAATT pLKO_005 2343 CDS 100% 13.200 9.240 N PLCB4 n/a
7 TRCN0000007009 CCTCTGAACAAAGCGGAGAAA pLKO.1 5194 3UTR 100% 4.950 3.465 N PLCB4 n/a
8 TRCN0000338211 CCTCTGAACAAAGCGGAGAAA pLKO_005 5194 3UTR 100% 4.950 3.465 N PLCB4 n/a
9 TRCN0000007013 CCTGAGATCAATCATACACAA pLKO.1 612 CDS 100% 4.950 3.465 N PLCB4 n/a
10 TRCN0000076920 CCCAGTGGAAAGAATGATGAA pLKO.1 802 CDS 100% 4.950 2.970 N Plcb4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024451902.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.