Transcript: Human XM_024452269.1

PREDICTED: Homo sapiens zinc finger protein 70 (ZNF70), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZNF70 (7621)
Length:
2832
CDS:
243..1583

Additional Resources:

NCBI RefSeq record:
XM_024452269.1
NBCI Gene record:
ZNF70 (7621)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000232167 CGGAAGATCCACACCCTAAAG pLKO_005 1053 CDS 100% 10.800 15.120 N ZNF70 n/a
2 TRCN0000017518 CCTCTCATTGAACAGGGCTTT pLKO.1 2803 3UTR 100% 4.050 5.670 N ZNF70 n/a
3 TRCN0000017521 CCCTAAAGAAACCTCACGAGT pLKO.1 1066 CDS 100% 2.640 3.696 N ZNF70 n/a
4 TRCN0000232170 AGAGGGAGAAAGTTGAATTAA pLKO_005 1927 3UTR 100% 15.000 10.500 N ZNF70 n/a
5 TRCN0000017519 GCCCTCATTGAGCACTATAAA pLKO.1 1455 CDS 100% 15.000 10.500 N ZNF70 n/a
6 TRCN0000232168 GCCCTCATTGAGCACTATAAA pLKO_005 1455 CDS 100% 15.000 10.500 N ZNF70 n/a
7 TRCN0000017520 GCCCTGTTCAGCATCAAAGTA pLKO.1 457 CDS 100% 5.625 3.938 N ZNF70 n/a
8 TRCN0000017522 CTTTGCATTTGAGAACAGGTT pLKO.1 278 CDS 100% 2.640 1.848 N ZNF70 n/a
9 TRCN0000232166 CTCAGCATGTGTCAGATAATC pLKO_005 543 CDS 100% 13.200 7.920 N ZNF70 n/a
10 TRCN0000232169 TCGCCATCAGAAGATTCATTC pLKO_005 1547 CDS 100% 10.800 6.480 N ZNF70 n/a
11 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 10 5UTR 100% 10.800 5.400 Y MRPS16 n/a
12 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 10 5UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452269.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.