Transcript: Human XM_024452351.1

PREDICTED: Homo sapiens acyl-CoA synthetase long chain family member 4 (ACSL4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ACSL4 (2182)
Length:
3654
CDS:
154..2307

Additional Resources:

NCBI RefSeq record:
XM_024452351.1
NBCI Gene record:
ACSL4 (2182)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000045541 GCAGTAGTTCATGGGCTAAAT pLKO.1 733 CDS 100% 13.200 9.240 N ACSL4 n/a
2 TRCN0000011984 GCCATGAAATTGGAGCGATTT pLKO.1 2146 CDS 100% 10.800 7.560 N Acsl4 n/a
3 TRCN0000278172 GCCATGAAATTGGAGCGATTT pLKO_005 2146 CDS 100% 10.800 7.560 N Acsl4 n/a
4 TRCN0000045539 CCAGTGTTGAACTTCTGGAAA pLKO.1 779 CDS 100% 4.950 3.465 N ACSL4 n/a
5 TRCN0000045542 CCTCAAAGACATTGAACGAAT pLKO.1 2271 CDS 100% 4.950 3.465 N ACSL4 n/a
6 TRCN0000045540 GCAGGAGAGTATGTATCTCTT pLKO.1 1906 CDS 100% 4.950 3.465 N ACSL4 n/a
7 TRCN0000045538 CCGGAAATCATGGATAGAATT pLKO.1 1294 CDS 100% 0.000 0.000 N ACSL4 n/a
8 TRCN0000011986 GCAGAGTGAATAACTTTGGAA pLKO.1 569 CDS 100% 3.000 4.200 N Acsl4 n/a
9 TRCN0000278174 GCAGAGTGAATAACTTTGGAA pLKO_005 569 CDS 100% 3.000 4.200 N Acsl4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452351.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06194 pDONR223 100% 93.3% 93.4% None 1_141del;1782A>G n/a
Download CSV