Transcript: Human XM_024452352.1

PREDICTED: Homo sapiens fibroblast growth factor 13 (FGF13), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FGF13 (2258)
Length:
2529
CDS:
452..1252

Additional Resources:

NCBI RefSeq record:
XM_024452352.1
NBCI Gene record:
FGF13 (2258)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430160 TAGATTGAGCTTGTGCATAAG pLKO_005 1435 3UTR 100% 10.800 15.120 N FGF13 n/a
2 TRCN0000059151 GAGCCACAATGAATCAACGTA pLKO.1 1231 CDS 100% 3.000 2.400 N FGF13 n/a
3 TRCN0000059148 CAGCACTTACACTCTGTTTAA pLKO.1 802 CDS 100% 13.200 9.240 N FGF13 n/a
4 TRCN0000423466 GAACAAGCCTGCAGCTCATTT pLKO_005 1075 CDS 100% 13.200 9.240 N FGF13 n/a
5 TRCN0000066936 CCTCAGCTTAAGGGTATAGTT pLKO.1 704 CDS 100% 5.625 3.938 N Fgf13 n/a
6 TRCN0000059149 AGGGTATAGTTACCAAGCTAT pLKO.1 714 CDS 100% 4.950 3.465 N FGF13 n/a
7 TRCN0000066934 GACAGCACTTACACTCTGTTT pLKO.1 800 CDS 100% 4.950 3.465 N Fgf13 n/a
8 TRCN0000059152 GAGATCATGAAAGGCAACCAT pLKO.1 1046 CDS 100% 3.000 2.100 N FGF13 n/a
9 TRCN0000059150 CAAGCTGTACTTGGCAATGAA pLKO.1 871 CDS 100% 5.625 3.375 N FGF13 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452352.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00559 pDONR223 100% 78.1% 71.2% None (many diffs) n/a
2 ccsbBroad304_00559 pLX_304 0% 78.1% 71.2% V5 (many diffs) n/a
Download CSV