Transcript: Human XM_024452491.1

PREDICTED: Homo sapiens phosphatidylinositol specific phospholipase C X domain containing 1 (PLCXD1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLCXD1 (55344)
Length:
1575
CDS:
37..1008

Additional Resources:

NCBI RefSeq record:
XM_024452491.1
NBCI Gene record:
PLCXD1 (55344)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000078247 CGGCTTCGTCAGTGACGTCAT pLKO.1 957 CDS 100% 1.350 1.080 N PLCXD1 n/a
2 TRCN0000303368 GAACCTGCACTTTGTCCATAT pLKO_005 384 CDS 100% 10.800 7.560 N PLCXD1 n/a
3 TRCN0000303367 GGAGGACACACTCACGGAAAT pLKO_005 426 CDS 100% 10.800 7.560 N PLCXD1 n/a
4 TRCN0000078244 CAACAGGTCATCGTCTCCTAT pLKO.1 622 CDS 100% 4.950 3.465 N PLCXD1 n/a
5 TRCN0000078246 CGCCTGTATCAAGAACATCTT pLKO.1 540 CDS 100% 4.950 3.465 N PLCXD1 n/a
6 TRCN0000291885 CGCCTGTATCAAGAACATCTT pLKO_005 540 CDS 100% 4.950 3.465 N PLCXD1 n/a
7 TRCN0000078245 GATGACGTACTGCCTGAACAA pLKO.1 177 CDS 100% 4.950 3.465 N PLCXD1 n/a
8 TRCN0000291886 GATGACGTACTGCCTGAACAA pLKO_005 177 CDS 100% 4.950 3.465 N PLCXD1 n/a
9 TRCN0000136653 GCCTGACCAACATGGTGAAAT pLKO.1 1236 3UTR 100% 13.200 6.600 Y IQCC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452491.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08527 pDONR223 100% 99.8% 100% None 6T>C n/a
2 ccsbBroad304_08527 pLX_304 0% 99.8% 100% V5 6T>C n/a
Download CSV