Transcript: Human XM_024452712.1

PREDICTED: Homo sapiens angio associated migratory cell protein (AAMP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
AAMP (14)
Length:
2002
CDS:
96..1475

Additional Resources:

NCBI RefSeq record:
XM_024452712.1
NBCI Gene record:
AAMP (14)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000152785 GAGACCACAAAGCGAAAGTAT pLKO.1 1550 3UTR 100% 5.625 3.938 N AAMP n/a
2 TRCN0000281195 GAGACCACAAAGCGAAAGTAT pLKO_005 1550 3UTR 100% 5.625 3.938 N AAMP n/a
3 TRCN0000152551 GAGATGGAAGATGTGGACTTT pLKO.1 231 CDS 100% 4.950 3.465 N AAMP n/a
4 TRCN0000152550 GAGATTATCGAGGTGGTAGAA pLKO.1 171 CDS 100% 4.950 3.465 N AAMP n/a
5 TRCN0000281196 GAGATTATCGAGGTGGTAGAA pLKO_005 171 CDS 100% 4.950 3.465 N AAMP n/a
6 TRCN0000155089 GATGGCAGCTTGATCCTAACT pLKO.1 906 CDS 100% 4.950 3.465 N AAMP n/a
7 TRCN0000153010 GATGTGGACTTTGAGGAAGAA pLKO.1 240 CDS 100% 4.950 3.465 N AAMP n/a
8 TRCN0000281128 GATGTGGACTTTGAGGAAGAA pLKO_005 240 CDS 100% 4.950 3.465 N AAMP n/a
9 TRCN0000153336 GAAGATGACAAAGCCTTCGTA pLKO.1 429 CDS 100% 3.000 2.100 N AAMP n/a
10 TRCN0000297939 GAAGATGACAAAGCCTTCGTA pLKO_005 429 CDS 100% 3.000 2.100 N AAMP n/a
11 TRCN0000155639 CAAGACCAATACCTTGGCAGT pLKO.1 398 CDS 100% 2.160 1.512 N AAMP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452712.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10668 pDONR223 100% 69.6% 70% None 1_138del;1072_1267del;1377_1378ins121 n/a
2 ccsbBroad304_10668 pLX_304 0% 69.6% 70% V5 1_138del;1072_1267del;1377_1378ins121 n/a
Download CSV