Transcript: Human XM_024452850.1

PREDICTED: Homo sapiens SP110 nuclear body protein (SP110), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SP110 (3431)
Length:
5706
CDS:
259..2055

Additional Resources:

NCBI RefSeq record:
XM_024452850.1
NBCI Gene record:
SP110 (3431)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452850.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421799 CCCAATCTGGTGACGATTTAC pLKO_005 556 CDS 100% 13.200 18.480 N SP110 n/a
2 TRCN0000425767 TTGACTTAGAGGCAGAATTTG pLKO_005 1967 CDS 100% 13.200 18.480 N SP110 n/a
3 TRCN0000019132 CGCAAAGAACTGGAAACGGAA pLKO.1 1656 CDS 100% 2.640 3.696 N SP110 n/a
4 TRCN0000019131 CCTCCTAGACAACTCCATCAT pLKO.1 384 CDS 100% 4.950 3.960 N SP110 n/a
5 TRCN0000420679 TCAAATTAACCTGCGTGAATA pLKO_005 534 CDS 100% 13.200 9.240 N SP110 n/a
6 TRCN0000019133 CCTGTCTCTTCTGGTGACATT pLKO.1 507 CDS 100% 4.950 3.465 N SP110 n/a
7 TRCN0000019130 CCAGAACCAAATGACCCAGAA pLKO.1 1045 CDS 100% 4.050 2.430 N SP110 n/a
8 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 5008 3UTR 100% 13.200 6.600 Y LIAS n/a
9 TRCN0000138772 GCAGGAGAATCGCTTGAACTT pLKO.1 5172 3UTR 100% 4.950 2.475 Y DCAF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452850.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13881 pDONR223 100% 75.8% 1.8% None (many diffs) n/a
2 ccsbBroad304_13881 pLX_304 0% 75.8% 1.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV