Transcript: Human XM_024452881.1

PREDICTED: Homo sapiens regulated endocrine specific protein 18 (RESP18), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RESP18 (389075)
Length:
797
CDS:
1..687

Additional Resources:

NCBI RefSeq record:
XM_024452881.1
NBCI Gene record:
RESP18 (389075)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024452881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122351 CAACCCTGTCAAGATTACCTA pLKO.1 543 CDS 100% 3.000 4.200 N RESP18 n/a
2 TRCN0000145462 GTCAAGATTACCTATAGGTGT pLKO.1 550 CDS 100% 2.640 3.696 N RESP18 n/a
3 TRCN0000122810 GTTGTGCTCCAGCAGATTATA pLKO.1 310 CDS 100% 15.000 10.500 N RESP18 n/a
4 TRCN0000122738 CCCAGGATGCAATGATCCAAA pLKO.1 362 CDS 100% 4.950 3.465 N RESP18 n/a
5 TRCN0000139285 CAAGAACCATGCCTGAAGGAT pLKO.1 412 CDS 100% 3.000 2.100 N RESP18 n/a
6 TRCN0000139214 CAAGGTCTGTTCTGGAAGGAT pLKO.1 334 CDS 100% 3.000 2.100 N RESP18 n/a
7 TRCN0000139686 CCAACCCTGTCAAGATTACCT pLKO.1 542 CDS 100% 3.000 2.100 N RESP18 n/a
8 TRCN0000140022 GATCAGTGCTTTACCTCCGAA pLKO.1 490 CDS 100% 2.640 1.848 N RESP18 n/a
9 TRCN0000144187 CCCTCTAAGGAAGAAATTATC pLKO.1 607 CDS 100% 13.200 7.920 N RESP18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024452881.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.