Transcript: Human XM_024453252.1

PREDICTED: Homo sapiens growth regulating estrogen receptor binding 1 (GREB1), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GREB1 (9687)
Length:
9169
CDS:
986..6835

Additional Resources:

NCBI RefSeq record:
XM_024453252.1
NBCI Gene record:
GREB1 (9687)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453252.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273203 TTCGCACTATCAGGGTATAAA pLKO_005 5263 CDS 100% 15.000 21.000 N GREB1 n/a
2 TRCN0000273201 TTTGTAGCGGTGCCAGTATTT pLKO_005 7192 3UTR 100% 13.200 10.560 N GREB1 n/a
3 TRCN0000000297 GTCACGAACATGGGCTCTTTA pLKO.1 5643 CDS 100% 13.200 9.240 N GREB1 n/a
4 TRCN0000000296 CAAAGGAGAAAGGACCACATT pLKO.1 7583 3UTR 100% 4.950 3.465 N GREB1 n/a
5 TRCN0000000299 ACTGGCAAAGAATAACCTGTT pLKO.1 1840 CDS 100% 4.050 2.835 N GREB1 n/a
6 TRCN0000273205 ACTGGCAAAGAATAACCTGTT pLKO_005 1840 CDS 100% 4.050 2.835 N GREB1 n/a
7 TRCN0000000300 GCCTTCTCTTACTCCATGCTA pLKO.1 5462 CDS 100% 3.000 2.100 N GREB1 n/a
8 TRCN0000273158 GCCTTCTCTTACTCCATGCTA pLKO_005 5462 CDS 100% 3.000 2.100 N GREB1 n/a
9 TRCN0000000298 GAAGTCAATTACGAGCTGGTT pLKO.1 2741 CDS 100% 2.640 1.848 N GREB1 n/a
10 TRCN0000273133 GAAGTCAATTACGAGCTGGTT pLKO_005 2741 CDS 100% 2.640 1.848 N GREB1 n/a
11 TRCN0000200523 CCAGTGATATTTAAAGGCCAT pLKO.1 2129 CDS 100% 2.160 1.512 N Greb1 n/a
12 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 8124 3UTR 100% 5.625 2.813 Y KLHL30 n/a
13 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 8124 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453252.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.