Transcript: Human XM_024453392.1

PREDICTED: Homo sapiens upstream transcription factor family member 3 (USF3), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
USF3 (205717)
Length:
16021
CDS:
2827..9462

Additional Resources:

NCBI RefSeq record:
XM_024453392.1
NBCI Gene record:
USF3 (205717)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417175 GATGGCCTTACACGATTATTT pLKO_005 6910 CDS 100% 15.000 21.000 N USF3 n/a
2 TRCN0000055773 GCCCACAAGTACCTAATGATA pLKO.1 8855 CDS 100% 5.625 7.875 N USF3 n/a
3 TRCN0000055777 CCTGCCCATAACATAAGCCAT pLKO.1 9409 CDS 100% 2.640 3.696 N USF3 n/a
4 TRCN0000417393 TACTGTAATAGGGTCTAATAA pLKO_005 4554 CDS 100% 15.000 12.000 N USF3 n/a
5 TRCN0000425759 CACACTAGCTAGTACTTATAA pLKO_005 5025 CDS 100% 15.000 10.500 N USF3 n/a
6 TRCN0000417602 TCTGATTGTCAGACGTTTAAA pLKO_005 7918 CDS 100% 15.000 10.500 N USF3 n/a
7 TRCN0000055775 CCACCCTTCAAATCACAGATA pLKO.1 6244 CDS 100% 4.950 3.465 N USF3 n/a
8 TRCN0000055774 CCTGAATACATTTGGTGCTTT pLKO.1 4836 CDS 100% 4.950 3.465 N USF3 n/a
9 TRCN0000055776 CCTGTATCTATTTCTGGAGTT pLKO.1 3307 CDS 100% 4.050 2.835 N USF3 n/a
10 TRCN0000082462 CCTCCCAAAGTGCCAGGATTA pLKO.1 11039 3UTR 100% 10.800 5.400 Y LOC388949 n/a
11 TRCN0000166364 CACACACACACACACACACAA pLKO.1 12267 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453392.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.