Transcript: Human XM_024453548.1

PREDICTED: Homo sapiens chromosome 3 open reading frame 18 (C3orf18), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C3orf18 (51161)
Length:
2171
CDS:
1056..1538

Additional Resources:

NCBI RefSeq record:
XM_024453548.1
NBCI Gene record:
C3orf18 (51161)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000436922 GTTTACCGATGTGGCCAATGC pLKO_005 512 5UTR 100% 4.050 5.670 N C3orf18 n/a
2 TRCN0000165646 GCTCATGCCCATGTACAACTT pLKO.1 338 5UTR 100% 4.950 3.465 N C3orf18 n/a
3 TRCN0000166347 CCAAGTTATAGGGACAGGGTA pLKO.1 999 5UTR 100% 2.640 1.848 N C3orf18 n/a
4 TRCN0000163843 CCTGCTGACTTTAGACTCTAA pLKO.1 695 5UTR 100% 4.950 2.970 N C3orf18 n/a
5 TRCN0000165293 GAAGAAGAAGAGGCTGGAGAA pLKO.1 305 5UTR 100% 4.050 2.430 N C3orf18 n/a
6 TRCN0000421086 GACCTACTCTGAAGATCTTCC pLKO_005 623 5UTR 100% 4.050 2.430 N C3orf18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453548.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.