Transcript: Human XM_024453856.1

PREDICTED: Homo sapiens cytochrome P450 family 4 subfamily Z member 1 (CYP4Z1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CYP4Z1 (199974)
Length:
1861
CDS:
72..1475

Additional Resources:

NCBI RefSeq record:
XM_024453856.1
NBCI Gene record:
CYP4Z1 (199974)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453856.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435628 CCTTTCGTATAAGAATTAATG pLKO_005 1484 3UTR 100% 13.200 9.240 N CYP4Z1 n/a
2 TRCN0000416817 TACATCCCTATGCCTTCATAC pLKO_005 1267 CDS 100% 10.800 6.480 N CYP4Z1 n/a
3 TRCN0000064627 CCTTTACTGCTTGGCAAAGTA pLKO.1 935 CDS 100% 5.625 3.375 N CYP4Z1 n/a
4 TRCN0000064626 GTAAAGGAGTTTGAGGTGTAT pLKO.1 144 CDS 100% 4.950 2.970 N CYP4Z1 n/a
5 TRCN0000064625 CCTTGAGATTCTCCAGGGAAA pLKO.1 1234 CDS 100% 4.050 2.025 Y CYP4Z1 n/a
6 TRCN0000064624 CCAGATTGTGAAACCTGGCTT pLKO.1 368 CDS 100% 2.640 1.320 Y CYP4Z1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453856.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.