Transcript: Human XM_024453870.1

PREDICTED: Homo sapiens family with sequence similarity 13 member A (FAM13A), transcript variant X21, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FAM13A (10144)
Length:
4416
CDS:
228..1982

Additional Resources:

NCBI RefSeq record:
XM_024453870.1
NBCI Gene record:
FAM13A (10144)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024453870.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000116131 GCAAGCCTAAACGTCAGAAAT pLKO.1 1618 CDS 100% 13.200 18.480 N FAM13A n/a
2 TRCN0000116129 CCTTTCTATTTGAGTGCTCAT pLKO.1 1263 CDS 100% 4.050 3.240 N FAM13A n/a
3 TRCN0000338951 TAATAACTCTGGAGGTCAAAG pLKO_005 1370 CDS 100% 10.800 7.560 N FAM13A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024453870.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11458 pDONR223 100% 34.5% 34.4% None 606_1752delinsG n/a
2 ccsbBroad304_11458 pLX_304 0% 34.5% 34.4% V5 606_1752delinsG n/a
Download CSV