Transcript: Mouse XM_030244138.1

PREDICTED: Mus musculus 6-pyruvoyl-tetrahydropterin synthase (Pts), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Pts (19286)
Length:
1612
CDS:
783..1016

Additional Resources:

NCBI RefSeq record:
XM_030244138.1
NBCI Gene record:
Pts (19286)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030244138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000374751 GCCTGTATTTAGATGTATTTA pLKO_005 1158 3UTR 100% 15.000 21.000 N Pts n/a
2 TRCN0000076198 CCGAGCATTAAAGTAATGTAA pLKO.1 1136 3UTR 100% 5.625 7.875 N Pts n/a
3 TRCN0000076200 CGACAACAACATCGTAGTCTA pLKO.1 983 CDS 100% 4.950 6.930 N Pts n/a
4 TRCN0000348239 CAGTCCTCTCAAGGCTATTTA pLKO_005 1292 3UTR 100% 15.000 10.500 N Pts n/a
5 TRCN0000076199 CGTAGTCTATAAAGGAGAATA pLKO.1 995 CDS 100% 13.200 9.240 N Pts n/a
6 TRCN0000374741 ACCTGGATGTGCCGTACTTTG pLKO_005 859 CDS 100% 10.800 7.560 N Pts n/a
7 TRCN0000363917 ATAGGTCTTAGGGTTGCTATT pLKO_005 1013 CDS 100% 10.800 7.560 N Pts n/a
8 TRCN0000374744 CCTGTTACAGGAATGGTTATG pLKO_005 771 5UTR 100% 10.800 7.560 N Pts n/a
9 TRCN0000076202 AGTGTTTGAAACCGACAACAA pLKO.1 971 CDS 100% 4.950 3.465 N Pts n/a
10 TRCN0000334384 AGTGTTTGAAACCGACAACAA pLKO_005 971 CDS 100% 4.950 3.465 N Pts n/a
11 TRCN0000076201 CCTCAAAGAATACATGGAGGA pLKO.1 803 CDS 100% 2.160 1.512 N Pts n/a
12 TRCN0000334418 CCTCAAAGAATACATGGAGGA pLKO_005 803 CDS 100% 2.160 1.512 N Pts n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030244138.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.