Transcript: Mouse XM_030246989.1

PREDICTED: Mus musculus histone deacetylase 9 (Hdac9), transcript variant X23, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Hdac9 (79221)
Length:
8382
CDS:
605..3661

Additional Resources:

NCBI RefSeq record:
XM_030246989.1
NBCI Gene record:
Hdac9 (79221)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030246989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000004858 GCAAAGATAGAGGACGAGAAA pLKO.1 990 CDS 100% 4.950 6.930 N HDAC9 n/a
2 TRCN0000194057 GCAAAGATAGAGGACGAGAAA pLKO.1 990 CDS 100% 4.950 6.930 N Hdac9 n/a
3 TRCN0000004855 CCATCCTACAAGTACACATTA pLKO.1 1187 CDS 100% 13.200 10.560 N HDAC9 n/a
4 TRCN0000194159 GCTCAAGATAGCAAGGATGAT pLKO.1 1214 CDS 100% 4.950 3.465 N Hdac9 n/a
5 TRCN0000175012 GAAAGAATTTCACCAGGCATT pLKO.1 1745 CDS 100% 4.050 2.835 N Hdac9 n/a
6 TRCN0000176073 GAGCACATCAAGGAACTTCTA pLKO.1 857 CDS 100% 4.950 2.970 N Hdac9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030246989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.