Transcript: Mouse XM_030251420.1

PREDICTED: Mus musculus zinc finger, MYM-type 3 (Zmym3), transcript variant X22, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Zmym3 (56364)
Length:
5299
CDS:
1609..4188

Additional Resources:

NCBI RefSeq record:
XM_030251420.1
NBCI Gene record:
Zmym3 (56364)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030251420.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098312 CCTGTGCTGTACCACTTCTTA pLKO.1 1656 CDS 100% 5.625 3.938 N Zmym3 n/a
2 TRCN0000098313 CCTCCTCAATACCCTCATGTT pLKO.1 3699 CDS 100% 4.950 3.465 N Zmym3 n/a
3 TRCN0000160183 CCTGTGTAAGAACTTTGAGAT pLKO.1 1590 5UTR 100% 4.950 3.465 N ZMYM3 n/a
4 TRCN0000098311 GCCTAGTTGTACTGGTCTCAA pLKO.1 3246 CDS 100% 4.950 3.465 N Zmym3 n/a
5 TRCN0000098310 GCCTCCCTTTAGTTCCATGAA pLKO.1 4941 3UTR 100% 4.950 3.465 N Zmym3 n/a
6 TRCN0000098314 CCCAAGTGTAGACTTCCTCTT pLKO.1 3102 CDS 100% 4.050 2.835 N Zmym3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030251420.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.