Transcript: Mouse XM_030251902.1

PREDICTED: Mus musculus N-terminal EF-hand calcium binding protein 3 (Necab3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Necab3 (56846)
Length:
1845
CDS:
378..1097

Additional Resources:

NCBI RefSeq record:
XM_030251902.1
NBCI Gene record:
Necab3 (56846)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030251902.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000120005 CCTCTGATACAGGGCGGAGTT pLKO.1 640 CDS 100% 1.350 1.890 N Necab3 n/a
2 TRCN0000120004 CCTGGTGGATTATGAATAATA pLKO.1 1072 CDS 100% 15.000 12.000 N Necab3 n/a
3 TRCN0000054081 CTGTATGAGTTCTGGCAGGAT pLKO.1 939 CDS 100% 2.640 2.112 N NECAB3 n/a
4 TRCN0000120003 GACCAGTTTGTCACACGATTT pLKO.1 420 CDS 100% 10.800 7.560 N Necab3 n/a
5 TRCN0000120002 GCCTATCATTTGCATGTCTTA pLKO.1 1646 3UTR 100% 4.950 3.465 N Necab3 n/a
6 TRCN0000120006 TCGTGCTTTGTGCTGCTACAT pLKO.1 845 CDS 100% 4.950 3.465 N Necab3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030251902.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.