Transcript: Mouse XM_030251907.1

PREDICTED: Mus musculus RNA binding motif, single stranded interacting protein 1 (Rbms1), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Rbms1 (56878)
Length:
4283
CDS:
318..1538

Additional Resources:

NCBI RefSeq record:
XM_030251907.1
NBCI Gene record:
Rbms1 (56878)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030251907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000096782 TCAAACCCTTTGGACAAGTTA pLKO.1 793 CDS 100% 5.625 3.938 N Rbms1 n/a
2 TRCN0000316310 TCAAACCCTTTGGACAAGTTA pLKO_005 793 CDS 100% 5.625 3.938 N Rbms1 n/a
3 TRCN0000096781 CCTATATTGCATCTCCTGTAT pLKO.1 1171 CDS 100% 4.950 3.465 N Rbms1 n/a
4 TRCN0000316210 CCTATATTGCATCTCCTGTAT pLKO_005 1171 CDS 100% 4.950 3.465 N Rbms1 n/a
5 TRCN0000074935 CCCTATATTGCATCTCCTGTA pLKO.1 1170 CDS 100% 4.050 2.835 N RBMS1 n/a
6 TRCN0000291048 CCCTATATTGCATCTCCTGTA pLKO_005 1170 CDS 100% 4.050 2.835 N RBMS1 n/a
7 TRCN0000096779 CGAAGGGAGTTCTTACCTGAA pLKO.1 1500 CDS 100% 4.050 2.835 N Rbms1 n/a
8 TRCN0000316209 CGAAGGGAGTTCTTACCTGAA pLKO_005 1500 CDS 100% 4.050 2.835 N Rbms1 n/a
9 TRCN0000096780 CCCAAACAAGTACATCCCTAA pLKO.1 1010 CDS 100% 4.050 2.430 N Rbms1 n/a
10 TRCN0000316289 CCCAAACAAGTACATCCCTAA pLKO_005 1010 CDS 100% 4.050 2.430 N Rbms1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030251907.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01383 pDONR223 100% 78.9% 79.5% None (many diffs) n/a
2 ccsbBroad304_01383 pLX_304 0% 78.9% 79.5% V5 (many diffs) n/a
Download CSV