Transcript: Mouse XM_030254386.1

PREDICTED: Mus musculus transcriptional adaptor 2B (Tada2b), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tada2b (231151)
Length:
3885
CDS:
563..1585

Additional Resources:

NCBI RefSeq record:
XM_030254386.1
NBCI Gene record:
Tada2b (231151)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030254386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000239006 ATGGAGGAGTCGGCCGAATAT pLKO_005 1226 CDS 100% 13.200 18.480 N Tada2b n/a
2 TRCN0000239007 GTGTTTGGGCTCGGAAGTAAA pLKO_005 2815 3UTR 100% 13.200 10.560 N Tada2b n/a
3 TRCN0000239009 ATGATTATGAGATAGAGTATG pLKO_005 834 CDS 100% 10.800 8.640 N Tada2b n/a
4 TRCN0000239008 TGTGACTGTGAAGACTATTAT pLKO_005 1429 CDS 100% 15.000 10.500 N Tada2b n/a
5 TRCN0000239010 TTATCTGGACAAGGTCCTAAA pLKO_005 1507 CDS 100% 10.800 7.560 N Tada2b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030254386.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12999 pDONR223 100% 83.7% 95.5% None (many diffs) n/a
2 ccsbBroad304_12999 pLX_304 0% 83.7% 95.5% V5 (many diffs) n/a
3 TRCN0000471791 TCACGCAAGCCACTCCTGCTGTTC pLX_317 37.2% 83.7% 95.5% V5 (many diffs) n/a
Download CSV