Transcript: Mouse XM_030255635.1

PREDICTED: Mus musculus hect domain and RLD 3 (Herc3), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Herc3 (73998)
Length:
5301
CDS:
1818..3824

Additional Resources:

NCBI RefSeq record:
XM_030255635.1
NBCI Gene record:
Herc3 (73998)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_030255635.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000041017 CCCGGTACTGTTTAACAACTA pLKO.1 2408 CDS 100% 4.950 6.930 N Herc3 n/a
2 TRCN0000041016 CGCTTATGTGAATTACATCTT pLKO.1 3344 CDS 100% 4.950 6.930 N Herc3 n/a
3 TRCN0000041013 GCTTTAAGTATCGTGTCGTTA pLKO.1 1576 5UTR 100% 4.950 6.930 N Herc3 n/a
4 TRCN0000041014 CCTCGACAACTATGAGGGTTT pLKO.1 3791 CDS 100% 4.050 2.835 N Herc3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_030255635.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.