Transcript: Human XR_001737106.1

PREDICTED: Homo sapiens membrane associated guanylate kinase, WW and PDZ domain containing 3 (MAGI3), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MAGI3 (260425)
Length:
6632
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737106.1
NBCI Gene record:
MAGI3 (260425)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737106.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000037865 CCAGGAGTTATTCCTCATAAA pLKO.1 3183 3UTR 100% 13.200 9.240 N MAGI3 n/a
2 TRCN0000333008 CCAGGAGTTATTCCTCATAAA pLKO_005 3183 3UTR 100% 13.200 9.240 N MAGI3 n/a
3 TRCN0000037864 CCTCACTTTATGTCGTGGTTA pLKO.1 2021 3UTR 100% 4.950 3.465 N MAGI3 n/a
4 TRCN0000037867 GCAATGGTTCTGGAGCAGAAT pLKO.1 2163 3UTR 100% 4.950 3.465 N MAGI3 n/a
5 TRCN0000333006 GCAATGGTTCTGGAGCAGAAT pLKO_005 2163 3UTR 100% 4.950 3.465 N MAGI3 n/a
6 TRCN0000037868 CCCTCAGTATGGGACATACTA pLKO.1 1610 3UTR 100% 0.563 0.394 N MAGI3 n/a
7 TRCN0000332940 CCCTCAGTATGGGACATACTA pLKO_005 1610 3UTR 100% 0.563 0.394 N MAGI3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737106.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.