Transcript: Human XR_001737248.1

PREDICTED: Homo sapiens formin binding protein 1 like (FNBP1L), transcript variant X3, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FNBP1L (54874)
Length:
5701
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001737248.1
NBCI Gene record:
FNBP1L (54874)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001737248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000421601 GGGAGTTTGCAGCCTAAATTA pLKO_005 2971 3UTR 100% 15.000 21.000 N FNBP1L n/a
2 TRCN0000415312 GTTGAATCTGCGTACGCATAT pLKO_005 737 3UTR 100% 10.800 15.120 N FNBP1L n/a
3 TRCN0000149452 GAGGGAAGTTACACTGATGAT pLKO.1 3145 3UTR 100% 4.950 6.930 N FNBP1L n/a
4 TRCN0000147691 GCTGGAAACAGATGGATAATA pLKO.1 601 3UTR 100% 15.000 10.500 N FNBP1L n/a
5 TRCN0000129142 GCAGCGCATTGATGAACTTAA pLKO.1 2862 3UTR 100% 13.200 9.240 N FNBP1L n/a
6 TRCN0000432170 TACTAACTTCATTAGCATTTC pLKO_005 3596 3UTR 100% 10.800 7.560 N FNBP1L n/a
7 TRCN0000130069 GAACAGAACTATGCGAAACAA pLKO.1 330 3UTR 100% 5.625 3.938 N FNBP1L n/a
8 TRCN0000130220 CCATTTCTGATGGGACTATCA pLKO.1 1093 3UTR 100% 4.950 3.465 N FNBP1L n/a
9 TRCN0000130551 GCCTACGAATGGAAATCCATA pLKO.1 3017 3UTR 100% 4.950 3.465 N FNBP1L n/a
10 TRCN0000201739 GCCTAAATTAGCAGAGACCAT pLKO.1 2982 3UTR 100% 2.640 1.848 N Fnbp1l n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001737248.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.