Transcript: Human XR_001738644.1

PREDICTED: Homo sapiens ankyrin and armadillo repeat containing (ANKAR), transcript variant X26, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANKAR (150709)
Length:
4198
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738644.1
NBCI Gene record:
ANKAR (150709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246072 CTACTGCCCTCTTAGACTATA pLKO_005 846 3UTR 100% 13.200 18.480 N ANKAR n/a
2 TRCN0000246073 CAATTACCTCCAGCTTATTAT pLKO_005 971 3UTR 100% 15.000 10.500 N ANKAR n/a
3 TRCN0000246070 TTAGAGATATGGACCATATTA pLKO_005 3682 3UTR 100% 15.000 10.500 N ANKAR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13265 pDONR223 100% 52.2% None (many diffs) n/a
2 ccsbBroad304_13265 pLX_304 0% 52.2% V5 (many diffs) n/a
3 TRCN0000477547 GAGAAACTAACTCCCATTCCAATT pLX_317 20.6% 52.2% V5 (many diffs) n/a
Download CSV