Transcript: Human XR_001738794.2

PREDICTED: Homo sapiens protein phosphatase, Mg2+/Mn2+ dependent 1B (PPM1B), transcript variant X5, misc_RNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PPM1B (5495)
Length:
1613
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001738794.2
NBCI Gene record:
PPM1B (5495)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XR_001738794.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000002448 GAGCAGAAGAGGATGAATTTA pLKO.1 1128 3UTR 100% 15.000 10.500 N PPM1B n/a
2 TRCN0000002449 ACACAAGGGAAGTCGAGATAA pLKO.1 1276 3UTR 100% 13.200 9.240 N PPM1B n/a
3 TRCN0000318555 ACACAAGGGAAGTCGAGATAA pLKO_005 1276 3UTR 100% 13.200 9.240 N PPM1B n/a
4 TRCN0000002451 GCTGGGAATGGTTTACGTTAT pLKO.1 488 3UTR 100% 10.800 7.560 N PPM1B n/a
5 TRCN0000318495 GCTGGGAATGGTTTACGTTAT pLKO_005 488 3UTR 100% 10.800 7.560 N PPM1B n/a
6 TRCN0000010709 CATCACTACTAACGAAGACTT pLKO.1 670 3UTR 100% 4.950 3.465 N PPM1B n/a
7 TRCN0000318554 CATCACTACTAACGAAGACTT pLKO_005 670 3UTR 100% 4.950 3.465 N PPM1B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001738794.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.